rs292589 chr7:135201214 T>C
- Sequence
tgaaaggagcagaattcttgctgg[T/C]gggaaggatggagtacaaactaca
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.36 | 1.19 | 1.92 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), fasting blood glucose, systolic blood pressure (sbp), triglycerides
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid