rs2926372 chr1:16727184 G>C
- Sequence
tataaaaacatttggtttggatat[G/C]tttgttagcttttagtcgacactt
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.74 | -1.16 | 2.00 | |||
| K562 (myelogenous leukemia) | 1.01 | -0.47 | 2.41 | |||
| HEK293T (embryonic kidney) | 1.42 | -1.20 | 2.33 |
Items per page:
1 – 3 of 3