rs293369 chr15:89087901 C>A
- Sequence
ccttcgggttcggtgactcacgac[C/A]cttcttcctctctcccgggatatg
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) periferal blood macrophages
- ASB for transcription factors
- OSR2_HUMAN PRD10_HUMAN CLOCK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OSR2_HUMAN | -2.21 | 2.00 | 1.50 | n/a | No Hit | |||
| PRD10_HUMAN | 1.11 | 2.28 | 2.00 | n/a | n/a | |||
| CLOCK_HUMAN | -0.98 | 1.45 | 1.42 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid