rs293884 chr8:4731646 G>A
- Sequence
gcactccaggagaaaggtgggaat[G/A]cacactttgcatgagtatcatttg
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | -1.30 | 1.59 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cognitive response of healthy volunteers to topiramate treatment as measure by the digit span backward cognitive test, hip bone mineral density (bmd), lp-pla2 activity, lp-pla2 mass, plasma renin activity, schizophrenia