rs295264 chr9:4839553 G>A
- Sequence
tcagacctcagaaggacagcacct[G/A]cttggtccaaagggtatgagattc
- ASB in cell types
- HepG2 (hepatoblastoma) liver
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.53 | 0.38 | 1.27 | |||
| liver | 0.91 | 0.25 | 1.33 |
Items per page:
1 – 2 of 2