rs2965155 chr19:44685199 T>C
- Sequence
cctggattgccctggcaggctctt[T/C]atgtaatcacacagatccttataa
- ASB in cell types
- A549 (lung carcinoma) HEK293 (embryonic kidney) upper lobe of left lung HepG2 (hepatoblastoma)
- ASB for transcription factors
- JUN_HUMAN EP300_HUMAN GCR_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.04 | 0.14 | 1.59 | n/a | No Hit | |||
| EP300_HUMAN | 2.05 | 2.35 | 1.89 | n/a | n/a | |||
| GCR_HUMAN | 2.37 | -3.20 | 2.00 | n/a | No Hit | |||
| CREB1_HUMAN | 1.37 | -1.21 | 1.67 | n/a | No Hit | |||
| PRDM1_HUMAN | 2.05 | -1.88 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP crohns disease, combined control dataset, gender differentiated, ldl cholesterol, serum creatinine, sporadic creutzfeldt-jakob disease, total cholesterol, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid