rs297547 chr5:58887067 C>T
- Sequence
gttcagaactcagttgtggagtgt[C/T]tctgacaatagactgagatactta
- ASB in cell types
- LNCaP (prostate carcinoma) gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.19 | -1.41 | 1.33 | |||
| gastroesophageal sphincter | 1.52 | -1.27 | 1.00 |
Items per page:
1 – 2 of 2