rs298319 chr2:156399292 G>C
- Sequence
tcaatgactgtcctcttggacatt[G/C]cgtattatatttgaattagatcag
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | -0.74 | 1.06 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), birth weight, ldl cholesterol change with statins, parkinsons disease, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Thyroid