rs298323 chr2:156401405 A>G
- Sequence
attatactactttagaactttatg[A/G]gattcttctgaaactctctttggt
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | -0.31 | 1.20 | 1.37 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), birth weight, ldl cholesterol change with statins, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Thyroid