rs2984293 chrX:72358562 G>A
- Sequence
tgggagggagcaggacagtgtgag[G/A]ttttatcatgctattcggaacagt
- ASB in cell types
- SK-N-SH (neuroblastoma)
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | -2.21 | 2.29 | 2.00 | 1.35 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
