rs298443 chr1:25978508 A>G
- Sequence
gtacagacagctagccgatcacca[A/G]atcttttcctcttcttcctggtct
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NCOR1_HUMAN IKZF1_HUMAN SMCA4_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NCOR1_HUMAN | -1.10 | 1.82 | 1.33 | n/a | n/a | |||
| IKZF1_HUMAN | -1.23 | 1.84 | 1.33 | n/a | No Hit | |||
| SMCA4_HUMAN | -1.30 | 1.96 | 1.33 | n/a | n/a | |||
| REQU_HUMAN | -0.86 | 1.85 | 1.33 | n/a | n/a | |||
| E4F1_HUMAN | -1.91 | 2.14 | 1.33 | n/a | n/a |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GRASP birth weight, fasting insulin, height, homa-ir, ldl cholesterol, triglycerides, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid