rs29938 chr19:33820576 T>C
- Sequence
cccgggctggacgcagaccagatc[T/C]cgcgggggtgggctgggaggcgcc
- ASB for transcription factors
- ZIC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | 2.26 | n/a | 4.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), college completion, diastolic blood pressure (dbp), obesity (body mass index (bmi)), obesity with early age of onset (age >2), systolic blood pressure (sbp), years of education