rs2994559 chr1:56329920 C>A
- Sequence
ggagatgttgctgtgaaggcttca[C/A]tttacttcaacatgcctatatgaa
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.30 | 0.67 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, height, infant head circumference, serum creatinine, systolic blood pressure (sbp), total cholesterol change with statins, triglycerides