rs2998277 chr1:22180285 A>C
- Sequence
ttccacttctgggcatataccccc[A/C]aaaaagtgaaatcagggctcagaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- PKNX1_HUMAN KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | -0.52 | 1.69 | 1.33 | n/a | No Hit | |||
| KDM1A_HUMAN | -1.22 | 1.70 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood