rs299883 chr1:54503176 G>T
- Sequence
ataaagaccttgctgataaaacag[G/T]ttgcagtaaaggagccagccaaaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | -1.46 | 1.72 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1