rs300519 chr12:78181808 G>C
- Sequence
aacgttagattccattatagaatg[G/C]agatagtacactgcttgccttaaa
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | -0.91 | 1.33 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.70 | 0.03 | 1.63 |
Items per page:
1 – 2 of 2