rs300520 chr12:78181763 A>G
- Sequence
ccaccagatgacgcttggaaacca[A/G]taatatgtatgttcctagccaacg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.75 | 0.18 | 1.62 | |||
| HeLa S3 (cervical adenocarcinoma) | -0.61 | 1.34 | 2.00 |
Items per page:
1 – 2 of 2