rs300761 chr2:70074 A>G
- Sequence
tcaacaaacctaattgttttgccc[A/G]tggcttttccaataaatgaaggca
- ASB in cell types
- VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -0.30 | 0.92 | 2.00 |
Items per page:
1 – 1 of 1