rs301008 chr12:95473920 T>G
- Sequence
aacttcaccctgcgcttgccgatt[T/G]gcttcgggaatgcccgaggcaccg
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) fetal bone marrow-derived mononuclear cells HepG2 (hepatoblastoma)
- ASB for transcription factors
- KMT2A_HUMAN SP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | 2.10 | 0.29 | 1.25 | n/a | n/a | |||
| SP2_HUMAN | 0.24 | 2.44 | 1.67 | n/a | No Hit |
Items per page:
1 – 2 of 2