rs30105 chr2:236885902 C>T
- Sequence
tttgcctcttaccatctccactga[C/T]ttgtactgttttacaccttcttgt
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.04 | -0.02 | 1.92 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, infant head circumference, lp-pla2 mass, parkinsons disease, refractive error, simpson-angus scale, sporadic creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Vagina