rs3011410 chr10:120746101 G>T
- Sequence
atcttatctgagccccagaagtta[G/T]tcagccatgcttgttgaatgaatg
- ASB in cell types
- periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | 1.53 | -1.41 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, crohns disease, fasting insulin, hdl cholesterol, hdl cholesterol change with statins, homa-b, homa-ir, irritible bowel syndrome, panic disorder