rs3013 chr12:48693873 G>C
- Sequence
agccttttccagaaaaggccgctc[G/C]gggttttctgaaccctctatgggc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- SMCA4_HUMAN NCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 2.17 | -0.93 | 2.00 | n/a | n/a | |||
| NCOR1_HUMAN | 2.12 | -0.55 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, ldl cholesterol, prop taste detection threshold, refractive error
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Breast_Mammary_Tissue, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid