rs3013763 chr1:53733252 C>T
- Sequence
actaagcttctcacgcaaatgaaa[C/T]gcagggagatgagtaactctgaga
- ASB in cell types
- coronary artery smooth muscle
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| coronary artery smooth muscle | -0.94 | 1.26 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Lung, Ovary, Whole_Blood