rs3015963 chr11:65422321 T>C
- Sequence
tcacgcgcgcctcccggcgggacg[T/C]gccctctgcagagatccctccgcc
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts R3/R4 erythroid cells
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 0.75 | 1.44 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Liver, Nerve_Tibial, Thyroid