rs301806 chr1:8422018 C>T
- Sequence
aggagatgaggagggaggcaacca[C/T]agggaaatgagaatgaatcccttc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.25 | 0.68 | 1.99 | |||
| K562 (myelogenous leukemia) | 0.16 | 0.46 | 1.32 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI allergic disease (asthma, hay fever or eczema), depressive symptoms (mtag), ease of getting up in the morning, eczema, major depressive disorder, well-being spectrum (multivariate analysis)
GRASP chronic kidney disease, ldl cholesterol, serum creatinine, total cholesterol, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Hippocampus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Whole_Blood