rs3020176 chr8:116935146 C>A
- Sequence
gtcatttgtatcattgtttactta[C/A]gtgtaatgtacatatgtttctccc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | n/a | 2.85 | 1.33 | 1.85 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP autism, hip bone mineral density (bmd), irritible bowel syndrome, lp-pla2 activity, major depressive disorder, maternal transmission distortion, obesity with early age of onset (age >2), spine bone mineral density (bmd), transmission distortion