rs303525 chr10:88810547 G>A
- Sequence
aaaattcaccaaccaagaaagcca[G/A]tgaaattcttattgaaaacaactg
- ASB in cell types
- T47D (invasive ductal carcinoma) PANC1 (pancreatic ductal adenocarcinoma) HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.46 | -0.37 | 1.33 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 0.91 | -0.91 | 1.00 | |||
| HeLa Kyoto (cervical adenocarcinoma) | -0.75 | 1.05 | 2.00 |
Items per page:
1 – 3 of 3