rs303995 chr19:55913864 G>A
- Sequence
gcctgaccagctcagcaccccaaa[G/A]acaccttctagccagtagaggggg
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.86 | -1.84 | 1.33 |
Items per page:
1 – 1 of 1