rs304073 chr3:4494702 A>C
- Sequence
ccagtggacagtccgtttcttgga[A/C]gtagctgagaattgaaggagcctg
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.88 | -0.16 | 1.75 | |||
| GM12878 (female B-cells) | 0.57 | 0.57 | 1.28 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP maternal transmission distortion, schizophrenia, severe diabetic retinopathy, spine bone mineral density (bmd), stabilized warfarin dose, tetrology of fallot, total cholesterol, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood