rs304126 chr15:100726441 A>G
- Sequence
ccagaacttccttacagggaatac[A/G]ggagccttagggatagcagggctc
- ASB in cell types
- HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | -0.35 | 1.44 | 1.11 |
Items per page:
1 – 1 of 1