rs304733 chr7:80324207 T>C
- Sequence
tgggtagcagaggacacatactta[T/C]agaaaaattcaatggcaatttgcc
- ASB in cell types
- SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 0.92 | 0.22 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, arthritis including non-rheumatoid, asthma, college completion, hip bone mineral density (bmd), longstanding arthritis