rs307694 chr9:33925370 T>A
- Sequence
gagcactttcacagaacacgagaa[T/A]tctccaggcaggaactaggctcac
- ASB in cell types
- human villous mesenchymal fibroblast cells erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| human villous mesenchymal fibroblast cells | 1.87 | -1.70 | 2.00 | |||
| erythroid progenitors | 1.74 | -1.45 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, aortic valve calcium, body mass index (bmi), fasting insulin, height, homa-b, homa-ir, infant head circumference, obesity with early age of onset (age >2), parkinsons disease, serum creatinine, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood