rs308051 chr19:3104158 G>C
- Sequence
tcggatgagcccccagctcctgct[G/C]tcagggctgcgccctcttgtggcg
- ASB in cell types
- H929 (plasma cell myeloma) HepG2 (hepatoblastoma) CD14+ monocytes GM10266 (male B-cells)
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | n/a | 2.22 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1