rs309315 chr2:7007824 C>T
- Sequence
gtgaatccgggttttcatattgaa[C/T]agatagaacaaacgggccgcgctg
- ASB in cell types
- K562 (myelogenous leukemia) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.14 | 0.70 | 1.99 | |||
| SK-N-SH (neuroblastoma) | -1.68 | 1.59 | 1.75 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Lung, Prostate, Spleen, Testis, Whole_Blood