rs310619 chr20:63496168 G>A
- Sequence
tccagcacccccttgctctccgtc[G/A]gggtcctgggacgccggccccctc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.11 | 0.72 | 1.96 | |||
| HEK293 (embryonic kidney) | 0.60 | -0.17 | 2.07 | |||
| foreskin keratinocyte | 0.37 | n/a | 2.50 |
Items per page:
1 – 3 of 3