rs311395 chr8:54166316 G>A
- Sequence
tggaaaagtaggttttgttatcac[G/A]aagtgaatgtagccggctcaaaat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) KMS-11
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.34 | -0.66 | 2.09 | |||
| KMS-11 | 2.50 | n/a | 2.00 |
Items per page:
1 – 2 of 2