rs311396 chr8:54166458 A>C
- Sequence
attcatgaatttataattcaacaa[A/C]cctgaaatacacacaggacacaat
- ASB in cell types
- KMS-11
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 | 2.18 | -2.87 | 2.00 |
Items per page:
1 – 1 of 1