rs311497 chr20:63589896 A>G
- Sequence
aggaaacgtgggacctgaagaccg[A/G]ttttccaggttgctctcgctgttc
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- GRHL2_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GRHL2_HUMAN | -1.89 | 2.03 | 1.50 | 4.97 | Concordant | |||
| FOXA1_HUMAN | -0.65 | 0.93 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP bipolar disorder, birth weight, hypertension (early onset hypertension), ldl cholesterol change with statins, recurrent major depressive disorder, ulcerative colitis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Ovary, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood