rs312172 chr12:104740843 A>G
- Sequence
cctaagaagccgcagagatgtctg[A/G]cttcctcagtgaacagcagatgga
- ASB in cell types
- monocyte-derived dendritic cells periferal blood macrophages CD14+ monocytes GM12891 (male B-cells)
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.23 | -1.42 | 1.93 | -2.43 | Concordant | |||
| STAT1_HUMAN | 1.85 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
