rs312934 chr19:3268724 A>G
- Sequence
cctgcctcccaccggagctacccc[A/G]agtgaggggcagtgtgtgtgttta
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.85 | -0.13 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diastolic blood pressure (dbp), fasting blood glucose, resistance to kuru in aged women despite likely exposure, systolic blood pressure (sbp), tetrology of fallot