rs313177 chr6:85323579 G>A
- Sequence
catttcagatgtctctatcttcag[G/A]tgagccccaaatgattcttacaaa
- ASB in cell types
- HEK293 (embryonic kidney) CD34+ hematopoietic stem cells erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.23 | -0.50 | 2.47 | |||
| CD34+ hematopoietic stem cells | -2.09 | 2.17 | 2.00 | |||
| erythroid progenitors | -1.88 | 1.95 | 2.00 |
Items per page:
1 – 3 of 3