rs3134629 chr2:38750363 T>C
- Sequence
aactggtgaaagtccgcaaatccc[T/C]gagaaactagacttttgacaaaat
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
- ASB for transcription factors
- RFOX2_HUMAN SOX6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFOX2_HUMAN | 2.11 | -3.00 | 2.00 | n/a | n/a | |||
| SOX6_HUMAN | 2.00 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Liver, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood