rs314167 chr5:170411290 A>G
- Sequence
cattatgatgcccattttacagat[A/G]aggaagctgaggttcaaagatatg
- ASB in cell types
- K562 (myelogenous leukemia) PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.24 | 0.85 | 1.97 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 1.27 | -1.54 | 1.33 |
Items per page:
1 – 2 of 2