rs314313 chr7:100825743 T>C
- Sequence
gcgttgctggatgggtgaaattaa[T/C]atttgtaaggcgctcagcacaggc
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.61 | -0.04 | 1.95 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.19 | 0.55 | 1.52 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, crohns disease, diastolic blood pressure (dbp), hip bone mineral density (bmd), irritible bowel syndrome, salmonella-induced pyroptosis, total cholesterol, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Hypothalamus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood