rs317815 chr18:57586478 G>A
- Sequence
cgaatcccccgggcgcgagggccc[G/A]ggcgccagctgcccgctctgccca
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.34 | 1.03 | 2.29 | |||
| K562 (myelogenous leukemia) | 0.35 | 0.66 | 1.37 | |||
| GM12878 (female B-cells) | 0.27 | 0.59 | 1.27 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis