rs318449 chr6:2932221 A>G
- Sequence
tgcgactgcagaaatggctgttgc[A/G]tggagaaaacatgagaatgaggct
- ASB in cell types
- GM12878 (female B-cells) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.23 | 0.65 | 1.35 | |||
| HepG2 (hepatoblastoma) | -0.29 | 0.64 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. alzheimers disease without psychotic symptoms), alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls), hdl cholesterol, hdl cholesterol change with statins, premature ovarian failure, spine bone mineral density (bmd), triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood