rs322754 chr7:128136115 G>A
- Sequence
ttacgcccccgcaggcgctctgat[G/A]ctgacatattaaaagaagcccgga
- ASB in cell types
- HEK293 (embryonic kidney) neural cell GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.16 | 0.93 | 1.93 | |||
| neural cell | 0.82 | -0.70 | 1.20 | |||
| GM12878 (female B-cells) | 0.54 | 0.68 | 1.28 |
Items per page:
1 – 3 of 3