rs322755 chr7:128135662 A>C
- Sequence
cagcggcgagagcgtgagagggga[A/C]gagctgggggtccgggccaaaagg
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.19 | 0.89 | 1.95 | |||
| GM12878 (female B-cells) | 0.37 | 0.59 | 1.26 | |||
| hepatocytes | 1.56 | -1.58 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg