rs326119 chr5:7869970 C>A
- Sequence
gcggttcattcaccgaaagccaag[C/A]ttttggtttgggtttcagtttaaa
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.72 | 0.86 | 2.89 | |||
| K562 (myelogenous leukemia) | 0.37 | 0.51 | 1.36 |
Items per page:
1 – 2 of 2