rs327268 chr5:38651035 T>C
- Sequence
ccttaataaaaagaaaaaaagaac[T/C]atacatcagctaaccggcagtgtg
- ASB in cell types
- HEK293 (embryonic kidney) periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.61 | -0.53 | 2.88 | |||
| periferal blood macrophages | 1.05 | -0.09 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, fasting blood glucose, parkinsons disease, refractive error, systolic blood pressure (sbp)
GTEx eQTL Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Testis, Thyroid